GC content is one of the most-used numbers in molecular biology. This calculator counts the guanine and cytosine in any sequence you paste, reports it as a percentage, and adds base composition, length, and a quick melting temperature estimate for primer work.
How it works
The sequence is cleaned of everything that is not a letter, then each base is
tallied. GC content is (G + C) / total valid bases x 100. AT content is the
complement, with uracil counted on the AT side for RNA. Ambiguity codes are
counted separately and left out of the percentage.
For melting temperature, short oligos under fourteen bases use the Wallace rule,
Tm = 2(A+T) + 4(G+C), while longer sequences use the basic GC formula, Tm = 64.9 + 41(G+C-16.4)/N. Both are rough guides rather than precise predictions.
Why GC content affects so many experimental parameters
The underlying chemistry: GC base pairs form three hydrogen bonds, while AT base pairs form only two. This extra bond means GC-rich sequences are harder to separate — they require more thermal energy to melt apart. Practical consequences:
PCR annealing temperature: The higher the GC content, the higher the melting temperature, and therefore the higher the annealing temperature you need in your PCR protocol. Two primers with similar melting temperatures will anneal together cleanly; a mismatched pair may cause one primer to bind non-specifically or not at all.
Sequencing quality: Regions with very high GC content (above 70–75%) can form stable secondary structures (hairpins, G-quadruplexes) that stall polymerases during sequencing and PCR. These appear as coverage dropouts in sequencing data and difficult-to-amplify regions in PCR.
Genome context: GC content varies significantly across genomes and within chromosomes. CpG islands — regions with unexpectedly high CG dinucleotide frequency — often mark gene promoters in vertebrates. Knowing the GC content of a region helps interpret coverage patterns and guide primer placement away from problematic zones.
Worked example
The 20-base primer ATGCGCGCTATAGGCCATGC contains 12 G or C bases out of 20 total, giving:
- GC content: 60%
- AT content: 40%
- Estimated Tm (long-oligo formula): approximately 58 °C
This primer has reasonably high GC content and would typically require an annealing temperature of about 53–58 °C in a standard PCR (annealing temperature is usually set 5 °C below the calculated Tm as a starting point).
If you were designing a reverse primer to pair with this one, you would aim for a similar GC content and Tm to avoid mismatched annealing efficiency between the two primers in the same reaction.
Interpreting the melting temperature estimate
The Wallace rule (Tm = 2(A+T) + 4(G+C)) is a rough approximation designed for short oligos under salt conditions close to standard. It assumes 50 mM salt and 50 nM oligo concentration; real PCR conditions differ. The basic GC formula for longer sequences is similarly approximate.
For final primer design, always use a nearest-neighbour thermodynamic model (like the one in Primer3 or IDT’s OligoAnalyzer), which accounts for the specific sequence context of each base pair, salt concentration, and oligo concentration. The estimate here is a quick sanity check, not a substitute for proper design software.
Tips for primer GC content
- Aim for 40–60% GC for balanced, predictable PCR behaviour
- Keep forward and reverse primers within 2–4 °C of each other in estimated Tm
- Avoid runs of four or more identical bases, especially GGG or CCC, which promote secondary structure
- Place G or C at the 3’ end when possible — a G/C clamp improves specificity at the critical extension site